Genetic Predisposition
Based on your genetic markers, your predisposition to this trait is shown below
Your Result
Higher Rosacea susceptibility predisposition
Was this result accurate for you?
Scientific Evidence
Understanding the Data
- SNP: A specific genetic marker relevant to this trait (e.g., rs2588978)
- Genotype: Your genetic makeup at the given SNP location (e.g., CC)
- Variant allele: The alternative DNA sequence at the SNP site
- Variant allele frequency: Percentage of population carrying this variant
- Variant found: Whether the variant was detected in your DNA file
FGD2 GeneCards
The protein encoded by this gene belongs to a family of guanine nucleotide exchange factors (GEFs) which control cytoskeleton-dependent membrane rearrangements by activating the cell division cycle 42 (CDC42) protein. This gene is expressed in B lymphocytes, macrophages, and dendritic cells. The encoded protein may play a role in leukocyte signaling and vesicle trafficking in antigen-presenting cells in the immune system.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs4714034 | T T | C | T | 57.55% | Detected |
HERC2 GeneCards
This gene belongs to the HERC gene family that encodes a group of unusually large proteins, which contain multiple structural domains. All members have at least 1 copy of an N-terminal region showing homology to the cell cycle regulator RCC1 and a C-terminal HECT (homologous to E6-AP C terminus) domain found in a number of E3 ubiquitin protein ligases. Genetic variations in this gene are associated with skin/hair/eye pigmentation variability. Multiple pseudogenes of this gene are located on chromosomes 15 and 16.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs1129038 | T T | C | T | 17.69% | Detected |
| rs12912427 | -- | A | G | 19.09% | No Data |
IGFBP3 GeneCards
This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP domain and a thyroglobulin type-I domain. The protein forms a ternary complex with insulin-like growth factor acid-labile subunit (IGFALS) and either insulin-like growth factor (IGF) I or II. In this form, it circulates in the plasma, prolonging the half-life of IGFs and altering their interaction with cell surface receptors. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs788731 | G A | G | A | 55.81% | Detected |
PCLO GeneCards
The protein encoded by this gene is part of the presynaptic cytoskeletal matrix, which is involved in establishing active synaptic zones and in synaptic vesicle trafficking. Variations in this gene have been associated with bipolar disorder and major depressive disorder. Two transcript variants encoding different isoforms have been found for this gene.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs11768410 | G T | G | T | 47.30% | Detected |
SLC45A2 GeneCards
This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs16891982 | G G | C | G | 27.50% | Detected |
AGR3 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs74500669 | -- | G | A | 0.92% | No Data |
AHR GeneCards
aryl hydrocarbon receptor
Genomic Location
No SNPs found for this gene in your DNA data.
AIF1 GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
ALG13 GeneCards
The protein encoded by this gene is a subunit of a bipartite UDP-N-acetylglucosamine transferase. It heterodimerizes with asparagine-linked glycosylation 14 homolog to form a functional UDP-GlcNAc glycosyltransferase that catalyzes the second sugar addition of the highly conserved oligosaccharide precursor in endoplasmic reticulum N-linked glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs201820102 | -- | C | C | 0.00% | No Data |
ARID1A GeneCards
This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene.
Genomic Location
No SNPs found for this gene in your DNA data.
ASB1 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs55775132 | -- | G | A | 7.23% | No Data |
ATP1B1 GeneCards
The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 1 subunit. Alternatively spliced transcript variants encoding different isoforms have been described, but their biological validity is not known.
Genomic Location
No SNPs found for this gene in your DNA data.
BTNL2 GeneCards
This gene encodes a major histocompatibility complex, class II associated, type I transmembrane protein which belongs to the butyrophilin-like B7 family of immunoregulators. It is thought to be involved in immune surveillance, serving as a negative T-cell regulator by decreasing T-cell proliferation and cytokine release. The encoded protein contains an N-terminal signal peptide, two pairs of immunoglobulin-like domains, separated by a heptad peptide sequence, and a C-terminal transmembrane domain. Naturally occurring mutations in this gene are associated with sarcoidosis, rheumatoid arthritis, ulcerative colitis, inflammatory bowel disease, myositis, type 1 diabetes, systemic lupus erythematosus, acute coronary syndrome, and prostate cancer.
Genomic Location
No SNPs found for this gene in your DNA data.
CAMTA1 GeneCards
The protein encoded by this gene contains a CG1 DNA-binding domain, a transcription factor immunoglobulin domain, ankyrin repeats, and calmodulin-binding IQ motifs. The encoded protein is thought to be a transcription factor and may be a tumor suppressor. However, a translocation event is sometimes observed between this gene and the WWTR1 gene, with the resulting WWTR1-CAMTA1 oncoprotein leading to epithelioid hemangioendothelioma, a malignant vascular cancer.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs12239076 | -- | C | G | 26.60% | No Data |
CETN3 GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
CFB GeneCards
This gene encodes complement factor B, a component of the alternative pathway of complement activation. Factor B circulates in the blood as a single chain polypeptide. Upon activation of the alternative pathway, it is cleaved by complement factor D yielding the noncatalytic chain Ba and the catalytic subunit Bb. The active subunit Bb is a serine protease which associates with C3b to form the alternative pathway C3 convertase. Bb is involved in the proliferation of preactivated B lymphocytes, while Ba inhibits their proliferation. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. This cluster includes several genes involved in regulation of the immune reaction. Polymorphisms in this gene are associated with a reduced risk of age-related macular degeneration. The polyadenylation site of this gene is 421 bp from the 5' end of the gene for complement component 2.
Genomic Location
No SNPs found for this gene in your DNA data.
COL11A2 GeneCards
This gene encodes one of the two alpha chains of type XI collagen, a minor fibrillar collagen. It is located on chromosome 6 very close to but separate from the gene for retinoid X receptor beta. Type XI collagen is a heterotrimer but the third alpha chain is a post-translationally modified alpha 1 type II chain. Proteolytic processing of this type XI chain produces PARP, a proline/arginine-rich protein that is an amino terminal domain. Mutations in this gene are associated with type III Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED syndrome), Weissenbacher-Zweymuller syndrome, autosomal dominant non-syndromic sensorineural type 13 deafness (DFNA13), and autosomal recessive non-syndromic sensorineural type 53 deafness (DFNB53). Alternative splicing results in multiple transcript variants. A related pseudogene is located nearby on chromosome 6.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs41317102 | -- | C | A | 9.38% | No Data |
CSMD3 GeneCards
CUB and Sushi multiple domains 3
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs146167956 | -- | C | T | 0.20% | No Data |
CSNK2A2 GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
CXXC4 GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
DCLK2 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs190788988 | -- | C | T | 0.14% | No Data |
DDR1 GeneCards
Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. The protein encoded by this gene belongs to a subfamily of tyrosine kinase receptors with homology to Dictyostelium discoideum protein discoidin I in their extracellular domain, and that are activated by various types of collagen. Expression of this protein is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.
Genomic Location
No SNPs found for this gene in your DNA data.
DGKB GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs142431388 | -- | C | G | 0.04% | No Data |
DIO2 GeneCards
iodothyronine deiodinase 2
Genomic Location
No SNPs found for this gene in your DNA data.
DNAJC11 GeneCards
DnaJ heat shock protein family (Hsp40) member C11
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs35724443 | -- | T | C | 9.68% | No Data |
DPF3 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs11628905 | -- | C | A | 2.18% | No Data |
DSCR4 GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
EHBP1L1 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs34278912 | -- | G | A | 12.98% | No Data |
EPDR1 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs146907294 | -- | G | A | 0.22% | No Data |
FANCA GeneCards
The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs75570604 | -- | G | C | 2.10% | No Data |
GBA3 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs192531874 | -- | T | T | 0.00% | No Data |
GNL1 GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
GRIN2A GeneCards
This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without cognitive disability. Alternative splicing results in multiple transcript variants.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs62035769 | -- | C | A | 48.42% | No Data |
GTF2B GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
HGF GeneCards
This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate alpha and beta chains, which form the mature heterodimer. This protein is secreted by mesenchymal cells and acts as a multi-functional cytokine on cells of mainly epithelial origin. This protein also plays a role in angiogenesis, tumorogenesis, and tissue regeneration. Although the encoded protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Mutations in this gene are associated with nonsyndromic hearing loss.
Genomic Location
No SNPs found for this gene in your DNA data.
HLA-C GeneCards
HLA-C belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. About 6000 HLA-C alleles have been described. The HLA system plays an important role in the occurrence and outcome of infectious diseases, including those caused by the malaria parasite, the human immunodeficiency virus (HIV), and the severe acute respiratory syndrome coronavirus (SARS-CoV). The structural spike and the nucleocapsid proteins of the novel coronavirus SARS-CoV-2, which causes coronavirus disease 2019 (COVID-19), are reported to contain multiple Class I epitopes with predicted HLA restrictions. Individual HLA genetic variation may help explain different immune responses to a virus across a population.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs4143333 | -- | A | G | 3.95% | No Data |
HLA-DMB GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
HLA-DPB1 GeneCards
HLA-DPB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DPA) and a beta chain (DPB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DP molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs56934772 | -- | T | C | 9.40% | No Data |
HMGN2 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs142065142 | -- | ? | ? | 0.00% | No Data |
HSD17B13 GeneCards
hydroxysteroid 17-beta dehydrogenase 13
Genomic Location
No SNPs found for this gene in your DNA data.
IGF1R GeneCards
This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs28415045 | -- | G | A | 30.57% | No Data |
IL13 GeneCards
This gene encodes an immunoregulatory cytokine produced primarily by activated Th2 cells. This cytokine is involved in several stages of B-cell maturation and differentiation. It up-regulates CD23 and MHC class II expression, and promotes IgE isotype switching of B cells. This cytokine down-regulates macrophage activity, thereby inhibits the production of pro-inflammatory cytokines and chemokines. This cytokine is found to be critical to the pathogenesis of allergen-induced asthma but operates through mechanisms independent of IgE and eosinophils. This gene, IL3, IL5, IL4, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL4.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs847 | -- | T | C | 75.30% | No Data |
IL5 GeneCards
This gene encodes a cytokine that acts as a growth and differentiation factor for both B cells and eosinophils. The encoded cytokine plays a major role in the regulation of eosinophil formation, maturation, recruitment and survival. The increased production of this cytokine may be related to pathogenesis of eosinophil-dependent inflammatory diseases. This cytokine functions by binding to its receptor, which is a heterodimer, whose beta subunit is shared with the receptors for interleukine 3 (IL3) and colony stimulating factor 2 (CSF2/GM-CSF). This gene is located on chromosome 5 within a cytokine gene cluster which includes interleukin 4 (IL4), interleukin 13 (IL13), and CSF2 . This gene, IL4, and IL13 may be regulated coordinately by long-range regulatory elements spread over 120 kilobases on chromosome 5q31.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs2078387 | -- | C | A | 69.05% | No Data |
IRF4 GeneCards
The protein encoded by this gene belongs to the IRF (interferon regulatory factor) family of transcription factors, characterized by an unique tryptophan pentad repeat DNA-binding domain. The IRFs are important in the regulation of interferons in response to infection by virus, and in the regulation of interferon-inducible genes. This family member is lymphocyte specific and negatively regulates Toll-like-receptor (TLR) signaling that is central to the activation of innate and adaptive immune systems. A chromosomal translocation involving this gene and the IgH locus, t(6
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs12203592 | -- | C | T | 3.67% | No Data |
KCNJ3 GeneCards
potassium inwardly rectifying channel subfamily J member 3
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs10191743 | -- | A | T | 91.81% | No Data |
| rs75561433 | -- | G | A | 2.72% | No Data |
KCNJ6 GeneCards
This gene encodes a member of the G protein-coupled inwardly-rectifying potassium channel family of inward rectifier potassium channels. This type of potassium channel allows a greater flow of potassium into the cell than out of it. These proteins modulate many physiological processes, including heart rate in cardiac cells and circuit activity in neuronal cells, through G-protein coupled receptor stimulation. Mutations in this gene are associated with Keppen-Lubinsky Syndrome, a rare condition characterized by severe developmental delay, facial dysmorphism, and intellectual disability.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs77704860 | -- | G | A | 17.49% | No Data |
KCNK7 GeneCards
potassium two pore domain channel subfamily K member 7
Genomic Location
No SNPs found for this gene in your DNA data.
KCNQ5 GeneCards
This gene is a member of the KCNQ potassium channel gene family that is differentially expressed in subregions of the brain and in skeletal muscle. The protein encoded by this gene yields currents that activate slowly with depolarization and can form heteromeric channels with the protein encoded by the KCNQ3 gene. Currents expressed from this protein have voltage dependences and inhibitor sensitivities in common with M-currents. They are also inhibited by M1 muscarinic receptor activation. Multiple transcript variants encoding different isoforms have been found for this gene.
Genomic Location
No SNPs found for this gene in your DNA data.
KCNV1 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs77184728 | -- | G | A | 0.14% | No Data |
KIAA1109 GeneCards
This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development.
Genomic Location
No SNPs found for this gene in your DNA data.
KLHL8 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs11097129 | -- | A | G | 19.13% | No Data |
LTBP1 GeneCards
latent transforming growth factor beta binding protein 1
Genomic Location
No SNPs found for this gene in your DNA data.
LYPLAL1 GeneCards
lysophospholipase like 1
Genomic Location
No SNPs found for this gene in your DNA data.
MAD1L1 GeneCards
MAD1L1 is a component of the mitotic spindle-assembly checkpoint that prevents the onset of anaphase until all chromosome are properly aligned at the metaphase plate. MAD1L1 functions as a homodimer and interacts with MAD2L1. MAD1L1 may play a role in cell cycle control and tumor suppression. Alternative splicing results in multiple transcript variants.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs202220630 | -- | CGGCTGGGATGGGAAGTCCT | C | 25.34% | No Data |
MBL2 GeneCards
This gene encodes the soluble mannose-binding lectin or mannose-binding protein found in serum. The protein encoded belongs to the collectin family and is an important element in the innate immune system. The protein recognizes and binds to mannose and N-acetylglucosamine on many microorganisms, including bacteria, yeast, and viruses including influenza virus, HIV and SARS-CoV. This binding activates the classical complement pathway. Deficiencies of this gene have been associated with susceptibility to autoimmune and infectious diseases.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs7075455 | -- | A | G | 45.89% | No Data |
MEF2C GeneCards
This locus encodes a member of the MADS box transcription enhancer factor 2 (MEF2) family of proteins, which play a role in myogenesis. The encoded protein, MEF2 polypeptide C, has both trans-activating and DNA binding activities. This protein may play a role in maintaining the differentiated state of muscle cells. Mutations and deletions at this locus have been associated with severe cognitive disability, stereotypic movements, epilepsy, and cerebral malformation. Alternatively spliced transcript variants have been described.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs151305263 | -- | G | A | 0.06% | No Data |
MGAT5 GeneCards
The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies.
Genomic Location
No SNPs found for this gene in your DNA data.
MICA GeneCards
This gene encodes the highly polymorphic major histocompatability complex class I chain-related protein A. The protein product is expressed on the cell surface, although unlike canonical class I molecules it does not seem to associate with beta-2-microglobulin. It is a ligand for the NKG2-D type II integral membrane protein receptor. The protein functions as a stress-induced antigen that is broadly recognized by intestinal epithelial gamma delta T cells. Variations in this gene have been associated with susceptibility to psoriasis 1 and psoriatic arthritis, and the shedding of MICA-related antibodies and ligands is involved in the progression from monoclonal gammopathy of undetermined significance to multiple myeloma. Alternative splicing of this gene results in multiple transcript variants.
Genomic Location
No SNPs found for this gene in your DNA data.
MICB GeneCards
This gene encodes a heavily glycosylated protein which is a ligand for the NKG2D type II receptor. Binding of the ligand activates the cytolytic response of natural killer (NK) cells, CD8 alphabeta T cells, and gammadelta T cells which express the receptor. This protein is stress-induced and is similar to MHC class I molecules
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs3130614 | -- | T | A | 2.60% | No Data |
MIR205HG GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs193183075 | -- | C | T | 0.06% | No Data |
MRPS22 GeneCards
Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that does not seem to have a counterpart in prokaryotic and fungal-mitochondrial ribosomes. This gene lies telomeric of and is transcribed in the opposite direction from the forkhead box L2 gene. A pseudogene corresponding to this gene is found on chromosome Xq.
Genomic Location
No SNPs found for this gene in your DNA data.
MYO3A GeneCards
The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs180789526 | -- | G | A | 0.02% | No Data |
NCAM2 GeneCards
neural cell adhesion molecule 2
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs117322572 | -- | C | T | 0.76% | No Data |
NCKAP5 GeneCards
NCK associated protein 5
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs200814246 | -- | ? | ? | 0.00% | No Data |
NCR3 GeneCards
The protein encoded by this gene is a natural cytotoxicity receptor (NCR) that may aid NK cells in the lysis of tumor cells. The encoded protein interacts with CD3-zeta (CD247), a T-cell receptor. A single nucleotide polymorphism in the 5' untranslated region of this gene has been associated with mild malaria suceptibility. Three transcript variants encoding different isoforms have been found for this gene.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs3132451 | -- | G | C | 13.60% | No Data |
NEGR1 GeneCards
neuronal growth regulator 1
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs145553345 | -- | G | C | 1.36% | No Data |
NRXN3 GeneCards
This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants and protein isoforms for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. Genetic variation at this locus has been associated with a range of behavioral phenotypes, including alcohol dependence and autism spectrum disorder.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs149851565 | -- | C | A | 11.24% | No Data |
NUFIP1 GeneCards
This gene encodes a nuclear RNA binding protein that contains a C2H2 zinc finger motif and a nuclear localization signal. This protein is associated with the nuclear matrix in perichromatin fibrils and, in neurons, localizes to the cytoplasm in association with endoplasmic reticulum ribosomes. This protein interacts with the fragile X mental retardation protein (FMRP), the tumor suppressor protein BRCA1, upregulates RNA polymerase II transcription, and is involved in box C/D snoRNP biogenesis. A pseudogene of this gene resides on chromosome 6q12.
Genomic Location
No SNPs found for this gene in your DNA data.
OVOL1 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs77779142 | -- | C | T | 10.60% | No Data |
PCDH15 GeneCards
This gene is a member of the cadherin superfamily. Family members encode integral membrane proteins that mediate calcium-dependent cell-cell adhesion. It plays an essential role in maintenance of normal retinal and cochlear function. Mutations in this gene result in hearing loss and Usher Syndrome Type IF (USH1F). Extensive alternative splicing resulting in multiple isoforms has been observed in the mouse ortholog. Similar alternatively spliced transcripts are inferred to occur in human, and additional variants are likely to occur.
Genomic Location
No SNPs found for this gene in your DNA data.
PCED1B GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs143178873 | -- | GGGAA | G | 82.79% | No Data |
PDCD6IP GeneCards
This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs78529895 | -- | A | G | 6.39% | No Data |
PDE4B GeneCards
This gene is a member of the type IV, cyclic AMP (cAMP)-specific, cyclic nucleotide phosphodiesterase (PDE) family. The encoded protein regulates the cellular concentrations of cyclic nucleotides and thereby play a role in signal transduction. Altered activity of this protein has been associated with schizophrenia and bipolar affective disorder. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs180826669 | -- | C | T | 0.12% | No Data |
PIK3R1 GeneCards
Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in four transcript variants encoding different isoforms.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs188276406 | -- | T | C | 0.20% | No Data |
PIM1 GeneCards
The protein encoded by this gene belongs to the Ser/Thr protein kinase family, and PIM subfamily. This gene is expressed primarily in B-lymphoid and myeloid cell lines, and is overexpressed in hematopoietic malignancies and in prostate cancer. It plays a role in signal transduction in blood cells, contributing to both cell proliferation and survival, and thus provides a selective advantage in tumorigenesis. Both the human and orthologous mouse genes have been reported to encode two isoforms (with preferential cellular localization) resulting from the use of alternative in-frame translation initiation codons, the upstream non-AUG (CUG) and downstream AUG codons (PMIDs:16186805, 1825810).
Genomic Location
No SNPs found for this gene in your DNA data.
PIN4 GeneCards
This gene encodes a member of the parvulin subfamily of the peptidyl-prolyl cis/trans isomerase protein family. The encoded protein catalyzes the isomerization of peptidylprolyl bonds, and may play a role in the cell cycle, chromatin remodeling, and/or ribosome biogenesis. The encoded protein may play an additional role in the mitochondria.
Genomic Location
No SNPs found for this gene in your DNA data.
PKN2 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs191805855 | -- | C | G | 0.16% | No Data |
PPARGC1A GeneCards
The protein encoded by this gene is a transcriptional coactivator that regulates the genes involved in energy metabolism. This protein interacts with PPARgamma, which permits the interaction of this protein with multiple transcription factors. This protein can interact with, and regulate the activities of, cAMP response element binding protein (CREB) and nuclear respiratory factors (NRFs). It provides a direct link between external physiological stimuli and the regulation of mitochondrial biogenesis, and is a major factor that regulates muscle fiber type determination. This protein may be also involved in controlling blood pressure, regulating cellular cholesterol homoeostasis, and the development of obesity.
Genomic Location
No SNPs found for this gene in your DNA data.
PPP2R2D GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
PRDM7 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs118174802 | -- | C | T | 1.10% | No Data |
PRKG1 GeneCards
Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs118006792 | -- | A | C | 0.08% | No Data |
PRSS58 GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
PSKH2 GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
PSMB9 GeneCards
proteasome 20S subunit beta 9
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs57390839 | -- | CTT | C | 1.58% | No Data |
PSORS1C1 GeneCards
This gene is one of several genes thought to confer susceptibility to psoriasis and systemic sclerosis, located on chromosome 6 near the major histocompatibility complex (MHC) class I region.
Genomic Location
No SNPs found for this gene in your DNA data.
PTGR2 GeneCards
prostaglandin reductase 2
Genomic Location
No SNPs found for this gene in your DNA data.
RAD50 GeneCards
The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Rad50, a protein involved in DNA double-strand break repair. This protein forms a complex with MRE11 and NBS1. The protein complex binds to DNA and displays numerous enzymatic activities that are required for nonhomologous joining of DNA ends. This protein, cooperating with its partners, is important for DNA double-strand break repair, cell cycle checkpoint activation, telomere maintenance, and meiotic recombination. Knockout studies of the mouse homolog suggest this gene is essential for cell growth and viability. Mutations in this gene are the cause of Nijmegen breakage syndrome-like disorder.
Genomic Location
No SNPs found for this gene in your DNA data.
RIMS1 GeneCards
The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs11758316 | -- | A | G | 11.50% | No Data |
RPAP3 GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
RPS29 GeneCards
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit and a member of the S14P family of ribosomal proteins. The protein, which contains a C2-C2 zinc finger-like domain that can bind to zinc, can enhance the tumor suppressor activity of Ras-related protein 1A (KREV1). It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs185236232 | -- | A | G | 0.12% | No Data |
SAA1 GeneCards
This gene encodes a member of the serum amyloid A family of apolipoproteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a major acute phase protein that is highly expressed in response to inflammation and tissue injury. This protein also plays an important role in HDL metabolism and cholesterol homeostasis. High levels of this protein are associated with chronic inflammatory diseases including atherosclerosis, rheumatoid arthritis, Alzheimer's disease and Crohn's disease. This protein may also be a potential biomarker for certain tumors. Finally, antimicrobial activity against S. aureus and E. coli resides in the N-terminal portion of the mature protein. Alternate splicing results in multiple transcript variants that encode the same protein. A pseudogene of this gene is found on chromosome 11.
Genomic Location
No SNPs found for this gene in your DNA data.
SEMA3C GeneCards
This gene encodes a secreted glycoprotein that belongs to the semaphorin class 3 family of neuronal guidance cues. The encoded protein contains an N-terminal sema domain, integrin and immunoglobulin-like domains, and a C-terminal basic domain. Homodimerization and proteolytic cleavage of the C-terminal propeptide are necessary for the function of the encoded protein. It binds a neuropilin co-receptor before forming a heterotrimeric complex with an associated plexin. An increase in the expression of this gene correlates with an increase in cancer cell invasion and adhesion. Naturally occurring mutations in this gene are associated with Hirschsprung disease.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs80105877 | -- | G | A | 5.97% | No Data |
SEMA3E GeneCards
Semaphorins are a large family of conserved secreted and membrane associated proteins which possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Based on sequence and structural similarities, semaphorins are put into eight classes: invertebrates contain classes 1 and 2, viruses have class V, and vertebrates contain classes 3-7. Semaphorins serve as axon guidance ligands via multimeric receptor complexes, some (if not all) containing plexin proteins. This gene encodes a class 4 semaphorin. This gene encodes a class 3 semaphorin. Multiple transcript variants encoding different isoforms have been found for this gene.
Genomic Location
No SNPs found for this gene in your DNA data.
SEMA5A GeneCards
This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs16882975 | -- | C | T | 0.82% | No Data |
SEMA6D GeneCards
Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs1369639 | -- | T | C | 9.31% | No Data |
SLC24A4 GeneCards
This gene encodes a member of the potassium-dependent sodium/calcium exchanger protein family. Alternative splicing results in multiple transcript variants.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs28671668 | -- | T | G | 38.80% | No Data |
SNX32 GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
SORCS3 GeneCards
sortilin related VPS10 domain containing receptor 3
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs78911933 | -- | G | A | 6.65% | No Data |
SOWAHA GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
STARD3NL GeneCards
Genomic Location
No SNPs found for this gene in your DNA data.
STK3 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs138330605 | -- | A | G | 0.12% | No Data |
SV2B GeneCards
This gene encodes a member of the synaptic vesicle proteins 2 (SV2) family and major facilitator superfamily of proteins. This protein and other members of the family are localized to synaptic vesicles and may function in the regulation of vesicle trafficking and exocytosis. Studies in mice suggest that the encoded protein may act as a protein receptor for botulinum neurotoxin E in neurons, and that this protein may be important for the integrity of the glomerular filtration barrier. This gene shows reduced expression in areas of synaptic loss in the hippocampus of human temporal lobe epilepsy patients.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs113042278 | -- | T | C | 7.93% | No Data |
TACR3 GeneCards
This gene belongs to a family of genes that function as receptors for tachykinins. Receptor affinities are specified by variations in the 5'-end of the sequence. The receptors belonging to this family are characterized by interactions with G proteins and 7 hydrophobic transmembrane regions. This gene encodes the receptor for the tachykinin neurokinin 3, also referred to as neurokinin B.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs75853901 | -- | C | G | 0.06% | No Data |
TARP GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs147606948 | -- | G | C | 0.36% | No Data |
TCERG1L GeneCards
transcription elongation regulator 1 like
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs12243257 | -- | G | A | 6.37% | No Data |
TGFB2 GeneCards
This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Disruption of the TGF-beta/SMAD pathway has been implicated in a variety of human cancers. A chromosomal translocation that includes this gene is associated with Peters' anomaly, a congenital defect of the anterior chamber of the eye. Mutations in this gene may be associated with Loeys-Dietz syndrome. This gene encodes multiple isoforms that may undergo similar proteolytic processing.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs628839 | -- | G | C | 67.03% | No Data |
TRIB1 GeneCards
tribbles pseudokinase 1
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs73705028 | -- | T | C | 5.73% | No Data |
TRPC3 GeneCards
The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs77937677 | -- | G | A | 7.33% | No Data |
TSC22D1 GeneCards
This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs11617859 | -- | C | T | 0.88% | No Data |
TTC27 GeneCards
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs58048037 | -- | T | C | 28.49% | No Data |
TUBB3 GeneCards
This gene encodes a class III member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is primarily expressed in neurons and may be involved in neurogenesis and axon guidance and maintenance. Mutations in this gene are the cause of congenital fibrosis of the extraocular muscles type 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6.
Genomic Location
No SNPs found for this gene in your DNA data.
TWIST2 GeneCards
The protein encoded by this gene is a basic helix-loop-helix type transcription factor and shares similarity with Twist. This protein may inhibit osteoblast maturation and maintain cells in a preosteoblast phenotype during osteoblast development. This gene may be upregulated in certain cancers. Mutations in this gene cause focal facial dermal dysplasia 3, Setleis type. Two transcript variants encoding the same protein have been found.
Genomic Location
No SNPs found for this gene in your DNA data.
WNT7B GeneCards
Wnt family member 7B
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs59614521 | -- | A | T | 18.53% | No Data |
ZNF100 GeneCards
zinc finger protein 100
Genomic Location
Associated SNPs
| SNP | Genotype | Ref. Allele | Variant Allele | Frequency | Status |
|---|---|---|---|---|---|
| rs12972593 | -- | G | C | 52.76% | No Data |
These are the genetic markers (SNPs) analyzed for this trait. Variations detected in your genome are listed under the "Genotype" column. SNPs showing "--" were not identified in your DNA file.
| SNP | Chromosome | Genotype | Variant Allele | Frequency |
|---|---|---|---|---|
| rs6598858 | 1 | CT | T | 38.86% |
| rs16891982 | 5 | GG | G | 27.50% |
| rs4714034 | 6 | TT | T | 57.55% |
| rs11768410 | 7 | GT | T | 47.30% |
| rs13223215 | 7 | CC | C | 90.77% |
| rs788731 | 7 | GA | A | 55.81% |
| rs7130337 | 11 | AG | G | 51.70% |
| rs1129038 | 15 | TT | T | 17.69% |
| rs1805007 | 16 | CT | T | 1.86% |
| rs5005856 | 1 | -- | G | 43.53% |
| rs145553345 | 1 | -- | C | 1.36% |
| rs180826669 | 1 | -- | T | 0.12% |
| rs35724443 | 1 | -- | C | 9.68% |
| rs193183075 | 1 | -- | T | 0.06% |
| rs191805855 | 1 | -- | G | 0.16% |
| rs12239076 | 1 | -- | G | 26.60% |
| rs142065142 | 1 | -- | ? | 0.00% |
| rs628839 | 1 | -- | C | 67.03% |
| rs10191743 | 2 | -- | T | 91.81% |
| rs55775132 | 2 | -- | A | 7.23% |
| rs58048037 | 2 | -- | C | 28.49% |
| rs75561433 | 2 | -- | A | 2.72% |
| rs200814246 | 2 | -- | ? | 0.00% |
| rs78529895 | 3 | -- | G | 6.39% |
| rs9853827 | 3 | -- | T | 31.63% |
| rs75853901 | 4 | -- | G | 0.06% |
| rs77937677 | 4 | -- | A | 7.33% |
| rs192531874 | 4 | -- | T | 0.00% |
| rs190788988 | 4 | -- | T | 0.14% |
| rs11097129 | 4 | -- | G | 19.13% |
| rs188276406 | 5 | -- | C | 0.20% |
| rs151305263 | 5 | -- | A | 0.06% |
| rs847 | 5 | -- | C | 75.30% |
| rs16882975 | 5 | -- | T | 0.82% |
| rs803141 | 5 | -- | T | 32.31% |
| rs2078387 | 5 | -- | A | 69.05% |
| rs9272729 | 6 | -- | A | 7.69% |
| rs57390839 | 6 | -- | C | 1.58% |
| rs2894254 | 6 | -- | G | 1.96% |
| rs11758316 | 6 | -- | G | 11.50% |
| rs1144710 | 6 | -- | T | 0.00% |
| rs56934772 | 6 | -- | C | 9.40% |
| rs4143333 | 6 | -- | G | 3.95% |
| rs3131115 | 6 | -- | T | 32.69% |
| rs3132580 | 6 | -- | A | 3.83% |
| rs3132451 | 6 | -- | C | 13.60% |
| rs3132649 | 6 | -- | A | 6.29% |
| rs519417 | 6 | -- | A | 3.25% |
| rs476080 | 6 | -- | T | 5.35% |
| rs12203592 | 6 | -- | T | 3.67% |
| rs41317102 | 6 | -- | A | 9.38% |
| rs142438673 | 6 | -- | A | 2.40% |
| rs3130614 | 6 | -- | A | 2.60% |
| rs3130976 | 6 | -- | C | 19.59% |
| rs1264350 | 6 | -- | C | 4.27% |
| rs146907294 | 7 | -- | A | 0.22% |
| rs202220630 | 7 | -- | C | 25.34% |
| rs147606948 | 7 | -- | C | 0.36% |
| rs74500669 | 7 | -- | A | 0.92% |
| rs142431388 | 7 | -- | G | 0.04% |
| rs80105877 | 7 | -- | A | 5.97% |
| rs144882124 | 8 | -- | G | 0.12% |
| rs146167956 | 8 | -- | T | 0.20% |
| rs183739760 | 8 | -- | A | 0.02% |
| rs73705028 | 8 | -- | C | 5.73% |
| rs147863159 | 8 | -- | T | 0.12% |
| rs138330605 | 8 | -- | G | 0.12% |
| rs77184728 | 8 | -- | A | 0.14% |
| rs78911933 | 10 | -- | A | 6.65% |
| rs180789526 | 10 | -- | A | 0.02% |
| rs7075455 | 10 | -- | G | 45.89% |
| rs118006792 | 10 | -- | C | 0.08% |
| rs12243257 | 10 | -- | A | 6.37% |
| rs77779142 | 11 | -- | T | 10.60% |
| rs719802 | 11 | -- | C | 49.34% |
| rs34278912 | 11 | -- | A | 12.98% |
| rs10859273 | 12 | -- | T | 21.43% |
| rs143178873 | 12 | -- | G | 82.79% |
| rs11617859 | 13 | -- | T | 0.88% |
| rs185236232 | 14 | -- | G | 0.12% |
| rs149851565 | 14 | -- | A | 11.24% |
| rs140328462 | 14 | -- | A | 3.21% |
| rs28671668 | 14 | -- | G | 38.80% |
| rs11628905 | 14 | -- | A | 2.18% |
| rs113042278 | 15 | -- | C | 7.93% |
| rs1369639 | 15 | -- | C | 9.31% |
| rs28415045 | 15 | -- | A | 30.57% |
| rs12912427 | 15 | -- | G | 19.09% |
| rs62035769 | 16 | -- | A | 48.42% |
| rs118174802 | 16 | -- | T | 1.10% |
| rs191291131 | 16 | -- | T | 0.02% |
| rs75570604 | 16 | -- | C | 2.10% |
| rs12972593 | 19 | -- | C | 52.76% |
| rs117322572 | 21 | -- | T | 0.76% |
| rs77704860 | 21 | -- | A | 17.49% |
| rs59614521 | 22 | -- | T | 18.53% |
| rs112004685 | X | -- | G | 0.00% |
| rs201820102 | X | -- | C | 0.00% |
The following peer-reviewed scientific studies support the genetic associations analyzed in this report.
What's Next?
Print Report
Download or print this report for your records